View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8063_low_17 (Length: 205)
Name: NF8063_low_17
Description: NF8063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8063_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 9044707 - 9044549
Alignment:
| Q |
15 |
aagaaccagaaagtaacattcccaatattatatggtgttaccgccagacaacctttttgcgagtgtgtttgtctcactctgatattcaagatcataattt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9044707 |
aagaaccagaaagtaacattcccaatattttatggtgttaccgccagacaacctttttgcgagtgtgtttgtctcact--gatattcaagatcataattt |
9044610 |
T |
|
| Q |
115 |
tgaatcccgaagagaaattttgtatgttagagtttatcagttgaatcctcactcctcaaat |
175 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9044609 |
tgaatcccgaagagaaattctgtatgttagagttgatcagttgaatcctcactcctcaaat |
9044549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University