View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8063_low_8 (Length: 350)
Name: NF8063_low_8
Description: NF8063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8063_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 323
Target Start/End: Original strand, 23800953 - 23801251
Alignment:
| Q |
19 |
gtgttatgctcatggcagacaagatttatgggttcgattgggttccattcttggtaataagagagagctgaattgnnnnnnnnnnnnnnngtgattttta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
23800953 |
gtgttatgctcatggcagacaagatttatgggttcgattgggttccattcttggtaacaagagagagctgaattggtgtgtgtg------gtgattttta |
23801046 |
T |
 |
| Q |
119 |
tgttgttaggtcttacactaagcggaagagtattgttattggcccaagttatgaagaggagattgttcttctatgagctttacttggtttagaggagatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23801047 |
tgttgttaggtcttacactaagcggaagagtagtgttattggcccaagttatgaagaggagattgttcttctgtgagctttacttggtttagaggagatt |
23801146 |
T |
 |
| Q |
219 |
gttcttctatgagtcgtcttgacatatttcttctcacaaaggaatggtgtgttcggtggcctcacatgattcaacaagctttaatgcgcggcctttcatc |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
23801147 |
gttcttctatgagtcgtcttgacagatttcttctctcaaaggaatggtgtgttcggtggcctcacatgattcaacaagctttatttcgcggcctttcata |
23801246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University