View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8064_low_6 (Length: 342)
Name: NF8064_low_6
Description: NF8064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8064_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 3145997 - 3145686
Alignment:
| Q |
16 |
aagtattgatgcttggatgtgagcatttgatttcagtttttcttcaacgatctcaaagaatgaaaacaaaactgtcttgttttctagtttttgcaacatc |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3145997 |
aagtattgatgcttggatatgagcatttgatttcagtttttcttcaacgatctcaaagaatgaaaacaaaactgtcttgttttctagttattgcaacatc |
3145898 |
T |
 |
| Q |
116 |
cttgaaaccttgtttccagatcactctaaggctcttgttctctagttaatctttgtgcttcaagctgatatgtggttgaaacttgaaactgtagttgagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
3145897 |
cttgaaaccttgtttccagatcactctaaggctcttgttctctagttaatctttgtgcttcaagttgatatgtggtatatacttgaaactgtagttgagt |
3145798 |
T |
 |
| Q |
216 |
aagacttttttgagaatcgacttgcttcatcacgtgtatatgcttaataagnnnnnnnntggcattaatttggtctgtttatcaagttttaactacttga |
315 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3145797 |
aagacatttttgagaatcgactcgcttcatcatgtgtatatgcttaataagaaaaaaaatggcattaatttggtctgtttatcaagttttaactacttga |
3145698 |
T |
 |
| Q |
316 |
cagtgtgagtat |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3145697 |
cagtgtgagtat |
3145686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 28910368 - 28910312
Alignment:
| Q |
16 |
aagtattgatgcttggatgtgagcatttgatttcagtttttcttcaacgatctcaaa |
72 |
Q |
| |
|
|||||||| |||||| || | || |||||||||||||||| ||||||| |||||||| |
|
|
| T |
28910368 |
aagtattgttgcttgcatatcagtatttgatttcagttttccttcaacaatctcaaa |
28910312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University