View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8066_high_10 (Length: 370)
Name: NF8066_high_10
Description: NF8066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8066_high_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 37651477 - 37651846
Alignment:
| Q |
1 |
gacaaaagttggttcaatcattgataagaggcactgttccttcctggtttttatcggctgatacgttggagcaggaggatggagaaactggagtgctggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37651477 |
gacaaaagttggttcaatcattgataagaggcactgttccttcctggtttttatcggctgatacgttggagcaggaggatggagaaactggagtgctggt |
37651576 |
T |
 |
| Q |
101 |
tgctatgcttagcggctatgcactggcgtattttgttatgcttagtgtagcatttgcatggggtattgaccattcttcagttccaccaaatcggcgagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37651577 |
tgctatgcttagcggctatgcactggcgtattttgttatgcttagtgtagcatttgcatggggtattgaccattcttcagttccaccaaatcgacgagca |
37651676 |
T |
 |
| Q |
201 |
aaggttattgcaattcatttggacttccttgcagacacaatggagaggtttacaacactgagttgccatcatgctacttggcaagcctatgtgtcaggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37651677 |
aaggttattgcaattcatttggacttccttgcagacacaatggagaggtttacaacactgagttgccatcatgctacttggcaagcctatgtgtcaggtt |
37651776 |
T |
 |
| Q |
301 |
ttgtgagcttgatagtgtgttgcactccaatgtggatccgcgaggttgatgcggaattgttgaagagact |
370 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37651777 |
ttgtgagcttgatagtgtgctgcactccaatgtggatccgtgaggttgatgcggaattgttgaagagact |
37651846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University