View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8066_low_15 (Length: 206)
Name: NF8066_low_15
Description: NF8066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8066_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 26 - 156
Target Start/End: Complemental strand, 9924595 - 9924464
Alignment:
| Q |
26 |
taaaagaattaagaacagacactagaacaattggaaaagggttggaaaacaccctctttgatgtgccagttgtactcctttgcctctaaa-catcatttt |
124 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
9924595 |
taaaagaattgagaacatgcactagaataattggaaaagggttggaaaacaccctctttgatgtgccagttgtactcctttgcctctaaaccatcaattt |
9924496 |
T |
 |
| Q |
125 |
ttccattaatatttttagatcaaaacatgctt |
156 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
9924495 |
ttccatgaatatttttagatcaaaacatgctt |
9924464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University