View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8066_low_9 (Length: 401)
Name: NF8066_low_9
Description: NF8066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8066_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 118 - 383
Target Start/End: Original strand, 35454813 - 35455080
Alignment:
| Q |
118 |
ttagtttgagtcaactaattaaatgtata--tgtgcaaaatataaatcttaattgtcattctaaaaagaattggatatacattacttgtgaattttcaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||| |||||||||||||| ||||| |||||| |
|
|
| T |
35454813 |
ttagtttgagtcaactaattaaatgtatatatgtgcaaaatataaatcttaattgctattctaaaaagtatttgatatacattacttatgaatcttcaat |
35454912 |
T |
|
| Q |
216 |
catgtgagaaatattcaaaatccagtcaaacttcaacatgatgtgcatgtttgccctctggagaagggagccttaaagtcataaaccatcgtcgggtcct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35454913 |
catgtgagaaatattcaaaatccagtcaaacttcaacatgatgtgcatgtttgccctttggagaagggagtcttaatgtcataaaccatcgtcgggtcct |
35455012 |
T |
|
| Q |
316 |
tgttggcttagttgcgttgaacgtgggcaactggtatgatagatagtaaaggacttgcaagcttatgt |
383 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35455013 |
tgttggtttagttgcgttgaacgtgggcaactggtatgatagatagtaaaggacttgcaagcttatgt |
35455080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University