View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8067_low_2 (Length: 328)
Name: NF8067_low_2
Description: NF8067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8067_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 166 - 311
Target Start/End: Original strand, 3342541 - 3342686
Alignment:
| Q |
166 |
gcctaagtttctatcgatatagggaagtaattctaaattcttttgatatgaaatcaagtacgtgtttatatacaggcgattggtcaannnnnnnaaaagc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3342541 |
gcctaagtttctaccgatatagggaagtaattctaaattcttttgatatgaaatcaagtacgtgtttatatacaggcgattggtcaatttttttaaaagc |
3342640 |
T |
|
| Q |
266 |
tggatttatttatcaagtgactcttgaatcttgatgtatagctaat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342641 |
tggatttatttatcaagtgactcttgaatcttgatgtatagctaat |
3342686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University