View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8068_high_2 (Length: 231)
Name: NF8068_high_2
Description: NF8068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8068_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 35162178 - 35162378
Alignment:
| Q |
17 |
agaaagagggctgattcggaactttttaaagctattatgaatggtaccgggcctactatttatacggctttggaaaagtgggttgaagatgggaaagaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35162178 |
agaaagagggctgattcggaactttttaaagctattatgaatggtaccgggcctactatttatacggctttggaaaagtgggttgaagatgggaaagaat |
35162277 |
T |
|
| Q |
117 |
tgagcagagaggagatttcactgactatgattaatctccggaggcggaagatttatttgaaagctttgcaggtaacttgattgagtttatgtttgtctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35162278 |
tgagcagagaggagatttcactgactatgattaatctccggaggcggaagatttatttgaaagctttgcaggtaacttgattgagtttatgtttgtttct |
35162377 |
T |
|
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
35162378 |
g |
35162378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University