View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8068_low_1 (Length: 427)
Name: NF8068_low_1
Description: NF8068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8068_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 191 - 406
Target Start/End: Complemental strand, 40052336 - 40052118
Alignment:
| Q |
191 |
atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggagg---taaatcggcat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40052336 |
atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggaggaggtaaatcggcat |
40052237 |
T |
|
| Q |
288 |
acacaacatcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgggaaagcatcttccaa |
387 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40052236 |
acacaacgtcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgggaaagcatcttccaa |
40052137 |
T |
|
| Q |
388 |
gtcaacaaaacaagacttc |
406 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40052136 |
gtcaacaaaacaagacttc |
40052118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 23 - 132
Target Start/End: Complemental strand, 40052500 - 40052394
Alignment:
| Q |
23 |
cagattttgtagtagtaactaatttcaacaactacttagaggcatagtttgtccaatctttggctctatttcatttgtaatcatgttgaagcctacggta |
122 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40052500 |
cagattttgcagaagtaactaatttcaacaact---tagaggcatagtttgtccaatctttggctctatttcatttgtaatcatgttgaagcctacggta |
40052404 |
T |
|
| Q |
123 |
cagttttatc |
132 |
Q |
| |
|
|| ||||||| |
|
|
| T |
40052403 |
caattttatc |
40052394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University