View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8068_low_2 (Length: 369)
Name: NF8068_low_2
Description: NF8068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8068_low_2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 12 - 369
Target Start/End: Original strand, 2162947 - 2163302
Alignment:
| Q |
12 |
gatggacatcaggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatttgagagtaaaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2162947 |
gatggtcatcaggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatgtgagagtaaaa |
2163046 |
T |
 |
| Q |
112 |
cacatagccccagttaaatcatatattttatttgtgaggacagagtcagtagcggagtggctgttctgaaaagaatttaggttatttctttataaaaagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2163047 |
cacatagccccagttaaatcatatattttatttgtgaggacagagtcagtagtggagtggctgttctgaaaagaatttaggttatttctttataaaaagc |
2163146 |
T |
 |
| Q |
212 |
ggtgttagattttgatgtcactttttaactattaactggtcttttataactttcgatagtgtatcttgggtcttttcctatagtattccgttgtagattt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2163147 |
ggtgttagattttgatgtcactttttaactattaactggtcttt--taactttctatagtgtatcttgggtcttttcctattgtattccgttgtagattt |
2163244 |
T |
 |
| Q |
312 |
gccttgcactcaatatatggcatgcaatctgtatctggtccctgatattcttcgacat |
369 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
2163245 |
gccttgcactcaatatatgacatgcaatctgtgtctggtccctgattttattcgacat |
2163302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University