View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8068_low_5 (Length: 231)

Name: NF8068_low_5
Description: NF8068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8068_low_5
NF8068_low_5
[»] chr7 (1 HSPs)
chr7 (17-217)||(35162178-35162378)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 35162178 - 35162378
Alignment:
17 agaaagagggctgattcggaactttttaaagctattatgaatggtaccgggcctactatttatacggctttggaaaagtgggttgaagatgggaaagaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35162178 agaaagagggctgattcggaactttttaaagctattatgaatggtaccgggcctactatttatacggctttggaaaagtgggttgaagatgggaaagaat 35162277  T
117 tgagcagagaggagatttcactgactatgattaatctccggaggcggaagatttatttgaaagctttgcaggtaacttgattgagtttatgtttgtctct 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
35162278 tgagcagagaggagatttcactgactatgattaatctccggaggcggaagatttatttgaaagctttgcaggtaacttgattgagtttatgtttgtttct 35162377  T
217 g 217  Q
    |    
35162378 g 35162378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University