View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_high_14 (Length: 399)
Name: NF8069_high_14
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 77 - 275
Target Start/End: Complemental strand, 10104397 - 10104208
Alignment:
| Q |
77 |
tgttggattgata-tatgttgttattgagctttcgtcgtccgtcacagaccgcgttgagtccttctccatcagtgggggtggtgtctatgcacgtgctcc |
175 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104397 |
tgttggattgataatatgttgttattgagctttcgtcgtccgtcacagaccgcgttgagtccttctccatcagtgggggtggtgtctatgcacgtgctcc |
10104298 |
T |
 |
| Q |
176 |
atcgcccatgtccgcccatgtcaacgaggggttcaatagatgctgacaattaaacatcaacaacaacaacacatgcaaatgaatcttttcttcaactatg |
275 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104297 |
atcgccca----------tgtcaattaggggttcaatagatgctgacaattaaacatcaacaacaacaacacatgcaaatgaatcttttcttcaactatg |
10104208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 338 - 389
Target Start/End: Complemental strand, 10104144 - 10104093
Alignment:
| Q |
338 |
gtgcttcatctctaacaaacaaagcacacaccatactttttcacattcatct |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10104144 |
gtgcttcatctctaacaaacaaagcacacaccatactttttcacattcatct |
10104093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 36312142 - 36312098
Alignment:
| Q |
18 |
gtatgaacgtccaacattggatggcggaagaataacgttaagtcg |
62 |
Q |
| |
|
||||||||||||||||||||| | | | ||||||||||||||||| |
|
|
| T |
36312142 |
gtatgaacgtccaacattggacgaccggagaataacgttaagtcg |
36312098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University