View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_11 (Length: 514)
Name: NF8069_low_11
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 1e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 402 - 484
Target Start/End: Complemental strand, 47212886 - 47212804
Alignment:
| Q |
402 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggtatattcttcg |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47212886 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggtatattattcg |
47212804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University