View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8069_low_16 (Length: 429)

Name: NF8069_low_16
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8069_low_16
NF8069_low_16
[»] chr7 (1 HSPs)
chr7 (329-413)||(19715147-19715231)
[»] chr3 (2 HSPs)
chr3 (329-413)||(12708447-12708531)
chr3 (329-401)||(12714381-12714453)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 329 - 413
Target Start/End: Complemental strand, 19715231 - 19715147
Alignment:
Q  329 cttaaccgaaccttttgatgcttttttatattttgatagaattataaacatcataatgctgacaaccatgcttatgtcctttatg 413  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||    
T  19715231 cttaaccgaaccttttgatgcttttttatattttgatagaattataaacatcataatgctaacaaccattcttctgtcctttatg 19715147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 329 - 413
Target Start/End: Original strand, 12708447 - 12708531
Alignment:
Q  329 cttaaccgaaccttttgatgcttttttatattttgatagaattataaacatcataatgctgacaaccatgcttatgtcctttatg 413  Q
    ||||||| ||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||| |||||||||||    
T  12708447 cttaaccaaaccttttgatgcttttttatattttgatagaattgtaaatatcacaatgctgacaaccatgcttctgtcctttatg 12708531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 329 - 401
Target Start/End: Original strand, 12714381 - 12714453
Alignment:
Q  329 cttaaccgaaccttttgatgcttttttatattttgatagaattataaacatcataatgctgacaaccatgctt 401  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||    
T  12714381 cttaaccaaaccttttgatgcttttttatattttgatagaattataaatatcataatgctgaccaccatgctt 12714453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University