View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_28 (Length: 269)
Name: NF8069_low_28
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 31262609 - 31262851
Alignment:
| Q |
12 |
atataaaggtgaaaatttgagttttactataacaggacacagtttaggagcagcattagcaattttaactgcgcatgatataaaaacatattttgatcag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31262609 |
atataaaggtgaaaatttgagttttactataacaggacacagtttaggagcagcattagcaattttaaccgcgcatgatataaaaacatattttgatcag |
31262708 |
T |
 |
| Q |
112 |
aaaccgttagtaacggtaatctcattcggcggtccacgtgttggtaacaagagtttccggttaaaactcgaaaaagaaggaatcaaagtgttgcgtatag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262709 |
aaaccgttagtaacggtaatctcattcggcggtccacgtgttggtaacaagagtttccggttaaaactcgaaaaagaaggaatcaaagtgttgcgtatag |
31262808 |
T |
 |
| Q |
212 |
taaactcagacgacgtaatcacgaaaatgccagggtttgtttt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262809 |
taaactcagacgacgtaatcacgaaaatgccagggtttgtttt |
31262851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University