View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_31 (Length: 253)
Name: NF8069_low_31
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_31 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 1488130 - 1488382
Alignment:
| Q |
1 |
atttcccacttgtgacagattgcaatttgaatctcactaacagaagtgttcatatttgaaaatgtttataggcaagttaatacaaaaaccatacatttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488130 |
atttcccacttgtgacagattgcaatttgaatctcactaacagaagtgttcatatttgaaaatgtttataggcaagttaatacaaaaaccatacatttac |
1488229 |
T |
|
| Q |
101 |
tttaatataaaaatggtcagataattttgttgcagtcttaaatatcctcttgtgtctgttttagatacacgtgatcgatcacattataagtgatactcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488230 |
tttaatataaaaatggtcagataattttgttgcagtcttaaatatcctcttgtgtctgttttagatacacgtgatcgatcacattataagtgatactcac |
1488329 |
T |
|
| Q |
201 |
aagggcattaaaagggtggaaggatgatatagttgaactttaattttgtttac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488330 |
aagggcattaaaagggtggaaggatgatatagttgaactttaattttgtttac |
1488382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University