View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_35 (Length: 232)
Name: NF8069_low_35
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 213
Target Start/End: Original strand, 2243359 - 2243560
Alignment:
| Q |
11 |
tgagatgaaaatggtaactaattaaaagaagaagnnnnnnnctctataggtgaggcctacattacccccaatcatcaaggagttatgtagaaaaaaccgg |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2243359 |
tgagatgaaaatggtaactaattgtaagaagaa-aaaacaactctataggtgaggcctacattacccccaatcatcaaggggttatgtagaaaaaaccgg |
2243457 |
T |
|
| Q |
111 |
tggatattcgtaactttttggcnnnnnnntctgaatgttaccttacatcatatagaagaagcctttaatcgttgttcaagagcctctcttatgcatttcc |
210 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2243458 |
tggatattcgtaactttttggcaaaaaaatatgaatgttaccttacatcatatagaagaagcctttaatcgttgttcaagagcctctcttatgcatttcc |
2243557 |
T |
|
| Q |
211 |
tcc |
213 |
Q |
| |
|
||| |
|
|
| T |
2243558 |
tcc |
2243560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University