View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_36 (Length: 228)
Name: NF8069_low_36
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 45 - 146
Target Start/End: Complemental strand, 28683911 - 28683810
Alignment:
| Q |
45 |
actgttcagctttttggttatgtgctgaatattttctaacacaatcaatttattcgcatgaaaaatagaacacactcacgtgatcttcatgaaatttatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| ||||||| |
|
|
| T |
28683911 |
actgttcagctttttggttatgtgctgaatattttctaacacaatcaatttattcgcatgaaaaataaaatacactcacgtgatcatcatgacatttatt |
28683812 |
T |
 |
| Q |
145 |
tt |
146 |
Q |
| |
|
|| |
|
|
| T |
28683811 |
tt |
28683810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 28683981 - 28683932
Alignment:
| Q |
1 |
ttaaataaagcatatgaaaaagttaaataagtctccaattcatcactgtt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28683981 |
ttaaataaagcatatgaaaaagttaaataagtctccaattcatcactgtt |
28683932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University