View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8069_low_6 (Length: 617)
Name: NF8069_low_6
Description: NF8069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8069_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 37146023 - 37146181
Alignment:
| Q |
18 |
attagttggaatgtaccaataccaactatataaacgaacgtttgtnnnnnnncgaatgtgtggagggtaatattaagaagaatatacatttaattttgtc |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37146023 |
attagttggaatgtactaataccaactatataaacgaacggttgtaagaagacgaatgtgtggagg-taatattaagaagaatatacatttaattttgtc |
37146121 |
T |
 |
| Q |
118 |
cataaactattaccct-ccaactaatttagcccttaaactgttaaaatcaactaaaagtt |
176 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37146122 |
cataaactattaccctccccactaatttagcccttaaactattaaaatcaactaaaagtt |
37146181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 358 - 473
Target Start/End: Original strand, 37146205 - 37146323
Alignment:
| Q |
358 |
ctaactcaaattgaaatatcaaaattgttttgtcaaatgttat---gatcgaagttcgaactccaactctttcacttaagtaaatgaattttcaattact |
454 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||| ||| ||||||||||| ||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
37146205 |
ctaactcaaatagaaatatcaaaattgttatgtcaaatgttattatgattgaagttcgaacctcaactttttcacttatgtaagtgaattttcaattact |
37146304 |
T |
 |
| Q |
455 |
attgtcattttgtctatct |
473 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37146305 |
attgtcattttgtctatct |
37146323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 47570435 - 47570483
Alignment:
| Q |
490 |
aataatccaaattgtaagatattatgactcttaaaaatatcacggtatt |
538 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47570435 |
aataatccaaatggtaagatattatgactcttaaaaatatcacggtatt |
47570483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University