View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8070_low_3 (Length: 318)
Name: NF8070_low_3
Description: NF8070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8070_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 16 - 307
Target Start/End: Original strand, 32180022 - 32180313
Alignment:
| Q |
16 |
atttcgcgccacgttgtttcattgcggtgatcacttttccgaaggattcaacgtcaagcacggcgagctcctccgtccaccaattcggaggtgatcggct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180022 |
atttcgcgccacgttgtttcattgcggtgatcacttttccgaaggattcaacgtcaagaacggcgagctcctccgtccaccaattcggaggtgatcggct |
32180121 |
T |
|
| Q |
116 |
agggaagtttgcttcattgcagacctttgagctgacagcgtcaacacagcgtttgacgatgtttagctcgtcggcgacggggataagctgacggcatgac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180122 |
agggaagtttgcttcattgcagacctttgagctgacagcgtcaacacagcgtttgacgatgtttagctcgtcggcgacggggataagctgacggcatgac |
32180221 |
T |
|
| Q |
216 |
tttagaacgactgcagcgccggaaagagttgttaatgcgacctgagatagaaaaccttcagttcttccggcgaggtttccgtcgcaatattc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180222 |
tttagaacgactgcagcgccggaaagagttgttaatgcgacctgagatagaaaaccttcagttcttccggcgaggtttccgtcgcaatattc |
32180313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 84 - 190
Target Start/End: Original strand, 28250485 - 28250591
Alignment:
| Q |
84 |
tcctccgtccaccaattcggaggtgatcggctagggaagtttgcttcattgcagacctttgagctgacagcgtcaacacagcgtttgacgatgtttagct |
183 |
Q |
| |
|
||||| ||||||||||| | ||||| ||||||||||| || || || ||||| |||| | ||| |||| |||||||||||||| ||||||||||| | |
|
|
| T |
28250485 |
tcctcagtccaccaattagccggtgagcggctagggaaattcgcctcgctgcaggccttggcgcttgcagcttcaacacagcgtttcacgatgtttaggt |
28250584 |
T |
|
| Q |
184 |
cgtcggc |
190 |
Q |
| |
|
| ||||| |
|
|
| T |
28250585 |
catcggc |
28250591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University