View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8070_low_6 (Length: 238)
Name: NF8070_low_6
Description: NF8070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8070_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 9797072 - 9797280
Alignment:
| Q |
20 |
gtgcttccatttgtttctgttgttactactagttgaccatttgcccttgtggtgctgctactcctacatc---atcatcttcttggaatctatgatctag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
9797072 |
gtgcttccatttgtttctgttgttactactagttgaccatttgcccttgtggtgctgctactcctacatcatcatcatcttgttggaatctatgatctat |
9797171 |
T |
 |
| Q |
117 |
attctatatatcaataccaatcactacataaatatttctctattaatactccctcggcccctaactatataagcccttaaa----atatatttatttccc |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9797172 |
attctatatattaataccaatcactacataaatatttctctattaatactccctcggcccctaac--tataagcccttaaaatatatatatttatttccc |
9797269 |
T |
 |
| Q |
213 |
cttaagtataa |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
9797270 |
cttaagtataa |
9797280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University