View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8071_high_5 (Length: 229)
Name: NF8071_high_5
Description: NF8071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8071_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 114 - 224
Target Start/End: Original strand, 6704515 - 6704625
Alignment:
| Q |
114 |
ccctatgagaagaaatttattatatctctttaacttataagtttttgtttttgaatagttacactactcctaacttgataatacatgaattccacttcca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6704515 |
ccctatgagaagaaatttattatatctctttaacttataagtttttgtttttgtatagttacactacacctaacttgataatacatgaattccacttcca |
6704614 |
T |
|
| Q |
214 |
ccaaacttaat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
6704615 |
ccaaacttaat |
6704625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 6704401 - 6704461
Alignment:
| Q |
1 |
cacatttataaattagttttaaaatggttcagttaggttcaactcaaaacaatgcattatg |
61 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6704401 |
cacatttacaaattagttttaaaatggttgagttaggttcaactcaaagtaatgcattatg |
6704461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University