View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8071_low_3 (Length: 360)
Name: NF8071_low_3
Description: NF8071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8071_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 4 - 342
Target Start/End: Complemental strand, 8174642 - 8174304
Alignment:
| Q |
4 |
tttggagcataaatcgaccattgatggataaatcaacaatagataccagtttacttgtgtgacaagttacaaatatattcaataccaactatatacttac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8174642 |
tttggagcataaatcgaccattgatggataaatcaacaatagataccagtttacttgtgtgacaagttacaaatatattcaataccaactatatacttac |
8174543 |
T |
 |
| Q |
104 |
tttagaagactcaaattcattgtcgcatccggtgttttagagtttatttgaatattgttaacctttctatgagatttaaccattgtttttatggcaattg |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8174542 |
tttagaggactcaaattcattgtcgcatccggtgttttagagtttatttgaatattgttaacctttctatgagatttaaccattgtttttatggcaattg |
8174443 |
T |
 |
| Q |
204 |
tgcagcatgtaaggaaaaatagagatccaagatggggtgaaacatttcaatttacactagaggaaccccccatcaatgagaggctttatgttgaagtgat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8174442 |
tgcagcatgtaaggaaaaatagagatccaagatggggtgaaacatttcaatttacactagaggaaccccccatcaatgagaggctttatgttgaagtgat |
8174343 |
T |
 |
| Q |
304 |
aagtgcatcctcaaagttaggcctgctgcatccaaaggt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8174342 |
aagtgcatcctcaaagttaggcctgctgcatccaaaggt |
8174304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University