View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8071_low_5 (Length: 239)
Name: NF8071_low_5
Description: NF8071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8071_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 11556442 - 11556233
Alignment:
| Q |
18 |
attttatatacttaagagcttgctcaaattccggtcgtgatatctttttctccatgtaacttgcaagaaggctagacactttctcacactgaaagttata |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11556442 |
attttatagacttaagagcttgctcaaattccggtcgtgatatctttttctccatgtaacttgcaagaaggctagacactttctcacactgaaagttata |
11556343 |
T |
|
| Q |
118 |
accaaataaattaggtaattatgcacacnnnnnnntaattaaaagagattaatcaaataaatgaattcactagcctcttgtttcagctgagcattttctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11556342 |
accaaataaattaggtaattatgcacacaaaaaattaattaaaagagattaatcaaataaatgaattcactagcctcttgtttcagctgagcattttctt |
11556243 |
T |
|
| Q |
218 |
gcttcatctc |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
11556242 |
gcttcatctc |
11556233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 124
Target Start/End: Complemental strand, 11542618 - 11542512
Alignment:
| Q |
18 |
attttatatacttaagagcttgctcaaattccggtcgtgatatctttttctccatgtaacttgcaagaaggctagacactttctcacactgaaagttata |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
11542618 |
attttatagacttaagagcttgctcaaactccggtcgtgatatctttttctccatgtaacttgcaagaaggctagacattttctcacactgaaagtcata |
11542519 |
T |
|
| Q |
118 |
accaaat |
124 |
Q |
| |
|
||||||| |
|
|
| T |
11542518 |
accaaat |
11542512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 156 - 223
Target Start/End: Complemental strand, 11542443 - 11542376
Alignment:
| Q |
156 |
ttaaaagagattaatcaaataaatgaattcactagcctcttgtttcagctgagcattttcttgcttca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11542443 |
ttaaaagagattaatcaaataaatgaattcactagcctcttgtttcagctgagcattttcttgcttca |
11542376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University