View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8072_high_5 (Length: 216)

Name: NF8072_high_5
Description: NF8072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8072_high_5
NF8072_high_5
[»] chr8 (2 HSPs)
chr8 (23-70)||(16486508-16486555)
chr8 (66-95)||(16486569-16486598)


Alignment Details
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 16486508 - 16486555
Alignment:
23 aagggttttattcgagttagtgtatgaaaaatgttttttgagaataga 70  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||    
16486508 aagggttttattcgatttagtgtatgaaaaatgttttttgagaataga 16486555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 95
Target Start/End: Original strand, 16486569 - 16486598
Alignment:
66 atagaattaatctttgcatttgtatgttaa 95  Q
    ||||||||||||||||||||||||||||||    
16486569 atagaattaatctttgcatttgtatgttaa 16486598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University