View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8072_low_6 (Length: 216)
Name: NF8072_low_6
Description: NF8072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8072_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 16486508 - 16486555
Alignment:
| Q |
23 |
aagggttttattcgagttagtgtatgaaaaatgttttttgagaataga |
70 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16486508 |
aagggttttattcgatttagtgtatgaaaaatgttttttgagaataga |
16486555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 95
Target Start/End: Original strand, 16486569 - 16486598
Alignment:
| Q |
66 |
atagaattaatctttgcatttgtatgttaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16486569 |
atagaattaatctttgcatttgtatgttaa |
16486598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University