View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8073_high_4 (Length: 259)
Name: NF8073_high_4
Description: NF8073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8073_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 25 - 233
Target Start/End: Original strand, 31693769 - 31693977
Alignment:
| Q |
25 |
gtttgatttgttctataaataagaaatttcctggaagtggcgacaatgaggctccttcatcaaggaaattgttgatctaatgcaatgacaaacaaacata |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693769 |
gtttgatttgttctataaatgagaaatttcgtggaagtggagacaatgaggctccttcatcaaggaaattgttgatctaatgcaatgacaaacaaacata |
31693868 |
T |
 |
| Q |
125 |
catccttccaatttatgggcataaataaata-gattaccacatgtagcaccaagttctggataaaaatataaataaattatttaaattagagatttttac |
223 |
Q |
| |
|
||||||||||||||| ||||||||||| | ||||||||||||| |||| || ||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31693869 |
tatccttccaatttataagcataaataaacatgattaccacatgtggcacgaacttctggatacaaatataaataaattatttaaattagaga-ttttac |
31693967 |
T |
 |
| Q |
224 |
tgatgttttt |
233 |
Q |
| |
|
||||| |||| |
|
|
| T |
31693968 |
tgatgctttt |
31693977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University