View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8074_low_6 (Length: 259)
Name: NF8074_low_6
Description: NF8074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8074_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 27 - 236
Target Start/End: Complemental strand, 23836906 - 23836695
Alignment:
| Q |
27 |
gctgtattttatttcttttattataaagaaaatgaatatctaatagattcattagttgtgtgcttataattgcatgcataatagaaaatgataataccat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23836906 |
gctgtattttatttcttttattataaagaaaatgaatatctaatagattcattagttgtgtgcttataattgtatgcataatagaaaatgataataccat |
23836807 |
T |
 |
| Q |
127 |
taaaatgcttgataatatatgttcacttgcgaaatgtaggactata-ataaaggataaatatgttgtatcaaaaaactagaat-aatgataaatgattaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23836806 |
taaaatgcttgataatatatgttcacttgcgaaatgtaggactatagataaaggataaatatgctgtatcaaaaaactagaataaatgataaatgattac |
23836707 |
T |
 |
| Q |
225 |
atgatagaatca |
236 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
23836706 |
attatagaatca |
23836695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University