View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8076_high_10 (Length: 281)

Name: NF8076_high_10
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8076_high_10
NF8076_high_10
[»] chr3 (1 HSPs)
chr3 (21-218)||(52799145-52799342)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 52799342 - 52799145
Alignment:
21 ggtggaatcgaaaaataaaatttgttgggtgaagtgggagcaaacgtgtaagccggaaaaagatggagggctaggtattagagatttggggttcatgaat 120  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||    
52799342 ggtggaatcgaaaaataaaatttgttgggcgaagtgggagcaaacgtgtaagccggaaaaagatgaagggctaggtattacagatttagggttcatgaat 52799243  T
121 ctagctctttttgcaaagtggagatgaaagttattagttgagaggggttctttgtggattgctaaacatggcgattgtgtcgtgttggtctagatgta 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
52799242 ctagctctttttgcaaagtggagatgaaagttattagttgagaggggttctttgtggattgctaaacatggtgattgtgtcgtgttggtctagatgta 52799145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University