View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_high_11 (Length: 255)
Name: NF8076_high_11
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 4 - 241
Target Start/End: Complemental strand, 43009460 - 43009223
Alignment:
| Q |
4 |
aaccaacaagactcaaaaacaaaaggaggtatactttgcttgctgacataatcaagaagatttcttaactttggcttattagtaagagagggaaggagaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009460 |
aaccaacaagactcaaaaacaaaaggaggtataatttgcttgctgacataatcaagaagatttcttaactttggcttattagtaagagagggaaggagaa |
43009361 |
T |
|
| Q |
104 |
gagtaacttgtttttagactggtggaacaatcatatttcatgtttagagtatgcttgattttcctcttgtaatcaaatttgagtaccctttgctctcttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009360 |
gagtaacttgtttttagactggtggaacaatcatatttcatgtttagagtatgcttgattttcctcttgtaatcaaatttgagtaccctttgctctcttt |
43009261 |
T |
|
| Q |
204 |
tcaataaatatttgcttataaaaataatatcacaaact |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009260 |
tcaataaatatttgcttataaaaataatatcacaaact |
43009223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University