View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_high_14 (Length: 227)
Name: NF8076_high_14
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 43009725 - 43009651
Alignment:
| Q |
1 |
cactgcaatacaatgtgtttcttcatatgaaatgctatacacaagtttcatacacttgtattgcaattggacttg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009725 |
cactgcaatacaatgtgtttcttcatatgaaatgctatacacaagtttcatacacttgtattgcaattggacttg |
43009651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 43009568 - 43009499
Alignment:
| Q |
158 |
ggttagtcgatcgatgtaaatattattcatattcaaattggtccatgaaatatttaatttaatataggga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009568 |
ggttagtcgatcgatgtaaatattattcatattcaaattggtccatgaaatatttaatttaatataggga |
43009499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University