View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_high_4 (Length: 430)
Name: NF8076_high_4
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 18 - 333
Target Start/End: Complemental strand, 45921484 - 45921166
Alignment:
| Q |
18 |
caaactcccgtaacccggcggtaactggtgtggtcagattcagtggaaactagctggtgcttttatttttaaaagataatatgctgaaagcggcctgcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45921484 |
caaactcccgtaacccggcggtaactggtgtggtcagattcagtggaaactagctggtgcttttatttttaaaagataatatgctgaaagcggcctgcac |
45921385 |
T |
|
| Q |
118 |
taaaatcgaatatacagcagtacactaccacagtgcaattttctgccaccgagtcagctgcttgttgatgttatcatgttgctttaagttttaattgata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45921384 |
taaaatcgaatatacagcagtacactaccacagtgcaattttctgccactgagtcagctgcttgttgatgttatcatgttgctttaagttttaattgata |
45921285 |
T |
|
| Q |
218 |
tagccgtatatagatgtgattttcttttggcttcaatgatatgatttttaaacatcaaaatataattaatacttgccnnnnnnnattg---aatatacat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
45921284 |
tagccgtatatagatgtgattttcttttggcttcaatgatatgatttttaaacatcaaaatataattaatacttgcctttttttattgataaatatacat |
45921185 |
T |
|
| Q |
315 |
gcctctcataaatacattc |
333 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45921184 |
gcctctcataaatacattc |
45921166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 397 - 430
Target Start/End: Complemental strand, 45921102 - 45921069
Alignment:
| Q |
397 |
gcgaccaagtcagctggcttaatctggctcatac |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45921102 |
gcgaccaagtcagctggcttaatctggctcatac |
45921069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University