View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_low_13 (Length: 246)
Name: NF8076_low_13
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45921024 - 45920791
Alignment:
| Q |
1 |
caagttcaattatgtggttaaaaat----aagtggttcaaccaatggccaaatacccttaccaagtcaatcaccaagccggttttaaaacactaatttaa |
96 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45921024 |
caagttcaattatgtggttaaaaatgatcaagtggttcaaccaatggccaaatacccttaccaagtcaatcaccaagccggttttaaaacactaatttaa |
45920925 |
T |
 |
| Q |
97 |
agttttagaattcttttcttttgaaatggcgtagtatttatttacccaatcaagtcttaccacaggtaagattggctatatagattaatcgaaccgatta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
45920924 |
agttttagaattcttttcttttgaaatggcgtagtatttatttacccaatcaagtcttaccacaggtgagattggct-----------tcgaaccgatta |
45920836 |
T |
 |
| Q |
197 |
gcctttattaataaccaaatttaaagtaaacttgattttcttctc |
241 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45920835 |
gtctttattaataaccaaatttaaagtaaactcgattttcttctc |
45920791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University