View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8076_low_15 (Length: 227)

Name: NF8076_low_15
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8076_low_15
NF8076_low_15
[»] chr4 (2 HSPs)
chr4 (1-75)||(43009651-43009725)
chr4 (158-227)||(43009499-43009568)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 43009725 - 43009651
Alignment:
1 cactgcaatacaatgtgtttcttcatatgaaatgctatacacaagtttcatacacttgtattgcaattggacttg 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43009725 cactgcaatacaatgtgtttcttcatatgaaatgctatacacaagtttcatacacttgtattgcaattggacttg 43009651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 158 - 227
Target Start/End: Complemental strand, 43009568 - 43009499
Alignment:
158 ggttagtcgatcgatgtaaatattattcatattcaaattggtccatgaaatatttaatttaatataggga 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43009568 ggttagtcgatcgatgtaaatattattcatattcaaattggtccatgaaatatttaatttaatataggga 43009499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University