View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_low_5 (Length: 374)
Name: NF8076_low_5
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 42331910 - 42331698
Alignment:
| Q |
18 |
aaaatagagtggaattgctgtttgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331910 |
aaaatagagtggaattgctgtttgttttgtatgaataggatgttttactctccattcgaagtggaatctgtgggttacgtcgctcaatggagactcagtt |
42331811 |
T |
 |
| Q |
118 |
ttaagagcatgaatatgattcctcacagctttatccacacgtccgaagctttcaagatatctaaatggaattggtaac--nnnnnnnctttctctcttct |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
42331810 |
ttaagagcatgaatatgattccccacagctttatccacacgtccgaagctttcaagatctctaaatggaattggtaactttttttttctttctctcttct |
42331711 |
T |
 |
| Q |
216 |
agttcgacaatac |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42331710 |
agttcgacaatac |
42331698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University