View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8076_low_7 (Length: 306)
Name: NF8076_low_7
Description: NF8076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8076_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 27 - 144
Target Start/End: Original strand, 22045959 - 22046076
Alignment:
| Q |
27 |
attcatcttttgttgtttgtttgtgtttgatatcatcatcatctgaaaatgtcttgctgtggtggaaactgtggttgtggaagtgcctgcaaatgcggca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22045959 |
attcatcttttgttgtttgtttgtgtttgatatcatcatcatctgaaaatgtcttgctgtggtggaaactgtggctgtggaagtgcctgcaaatgcggca |
22046058 |
T |
 |
| Q |
127 |
atggctgtggagggtgag |
144 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22046059 |
atggctgtggagggtgag |
22046076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University