View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8080_low_6 (Length: 217)
Name: NF8080_low_6
Description: NF8080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8080_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 34085479 - 34085668
Alignment:
| Q |
12 |
tgagatgaataagggtatacgtgagaggtatagatgatgatgttgttggtaagattcgttttctaattgagaataggttaaaatgtgaaagaaagaggaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085479 |
tgagaggaataagggtatacgtgagaggtatagatgatgatgttgttggtaagattcgttttctaattgagaataggttaaaatgtgaaagaaagaggaa |
34085578 |
T |
|
| Q |
112 |
gaaggtagtagtaaggtttgtggttagaagtttttatcgtgatagtgaaggtagagtcgtggaatgtggatagtagttacataaacattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085579 |
gaaggtagtagtaaggtttgtggttagaagtttttatcgtgatagtgaaggtagagtcgtggaatgtggatagtagttacataaacattg |
34085668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University