View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8081_high_11 (Length: 285)
Name: NF8081_high_11
Description: NF8081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8081_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 105 - 273
Target Start/End: Original strand, 43062205 - 43062373
Alignment:
| Q |
105 |
gaaatacgtagtaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062205 |
gaaatacgtagcaacacactggtatcagagctcccaaaagatcataggagtcatgcaaccttccatattgctttgatatgttgatctgttttttcataaa |
43062304 |
T |
|
| Q |
205 |
atctagttccgatttccaatgttttttgtcactgattcgtattactgacctctgtattgcataatgttg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43062305 |
atctagttccgatttccaatgttttttgtcactgattcgtattattgacctctgtattgcataatgttg |
43062373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University