View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8081_high_12 (Length: 274)
Name: NF8081_high_12
Description: NF8081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8081_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 42385533 - 42385319
Alignment:
| Q |
19 |
aactaggatatggactgtctacctttgaggaggtataaccaggtataactaaggtacatatgcaaaagatagtgtatttgcataaatgtcgatgttacac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42385533 |
aactaggatatggactgtctacctttgaggaggtataactaggta-----------catatgcaaaagatagtgtatttgcataaatgtcgatgttacac |
42385445 |
T |
 |
| Q |
119 |
accattatcattgtaaccatctctatgttaatgccaccaca--agagccttctaatacccgtcagctatgacaaataatatgattgttcaatagtcacct |
216 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42385444 |
accattatcattgtaaccttctccatgttaatgccaccacagcagagccttctaatacccgtcagctatgacaaataatatgattgttcaataggcacct |
42385345 |
T |
 |
| Q |
217 |
cgatttccctcttatcgtaacttctt |
242 |
Q |
| |
|
| ||||| |||||||||||||||||| |
|
|
| T |
42385344 |
caatttcgctcttatcgtaacttctt |
42385319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University