View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8081_low_19 (Length: 259)
Name: NF8081_low_19
Description: NF8081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8081_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 12146863 - 12146705
Alignment:
| Q |
1 |
attatgactaataaaatactaatatattttattctactattattttcataatatcaccaacagtttactatcattgagaaatgaatattattactnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
12146863 |
attatgactaataaaatactaatatattttattctactattattttaataatatcaccaacagtttactatcatt--gaaatgaa---tattactaaaaa |
12146769 |
T |
|
| Q |
101 |
nngttggttagtttcagccaaattttatgcttgcacgctaccttcttgattaattaagatagtt |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12146768 |
aagttggttagtttcaaccaaattttatgcttgcacgctaccttcttgattaattaagatagtt |
12146705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 151 - 244
Target Start/End: Complemental strand, 12146685 - 12146592
Alignment:
| Q |
151 |
taattaagatagttaattatagcaatataatgagtcatatgaattagacatatgcttttgaagatgcatggtgtaaaaacagataggatggtga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12146685 |
taattaagatagttaattatagcaatataatgagtcatatgaattaggcatatgcttttgaagatgcatggtgtaaaaacagataggatggtga |
12146592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University