View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8082_high_4 (Length: 383)
Name: NF8082_high_4
Description: NF8082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8082_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 6e-84; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 131 - 300
Target Start/End: Complemental strand, 39720437 - 39720268
Alignment:
| Q |
131 |
aataccgtttcgcggcagaggctgaggaacgaggagtgcagcggatcagcttgttggtgatacgcgtgagggtctaggttacaaactaaacatggaactt |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39720437 |
aataccgtttcgcggcagaggctgtggaacgaggagtgcagcggatcagcttgttggtgatacgcgtgagggtctaggttacaaactaaacatggaactt |
39720338 |
T |
|
| Q |
231 |
agcttgggtttggaaaattttgaacttatggaagatgtccacaatgattgggggaatgcggtgctgtcag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
39720337 |
agcttgggtttggaaaattttgaacttatggaagatgttcacaatgattgggggaatacggtgctgtcag |
39720268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 293 - 365
Target Start/End: Complemental strand, 39719245 - 39719173
Alignment:
| Q |
293 |
gctgtcagaccgtcaagttataacagcagccatgaaatcaattgcaccgattgtgaccactggtaaatatggt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39719245 |
gctgtcagaccgtcaagttataacagcagccatgaaatcaattgcaccgattgtgaccaccggtaaatatggt |
39719173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 39841552 - 39841619
Alignment:
| Q |
16 |
atcaagaaagctcagtattattattataaatataattagaatcatttcgcatatacatatgcttcagc |
83 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39841552 |
atcaagatagcttagtattattattataaatataattagaatcatttcgcatatacatatgtttcagc |
39841619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 40 - 83
Target Start/End: Complemental strand, 39730452 - 39730409
Alignment:
| Q |
40 |
tataaatataattagaatcatttcgcatatacatatgcttcagc |
83 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
39730452 |
tataaatataatcagaatcatttctcatatacatatgcttcagc |
39730409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University