View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8082_low_8 (Length: 346)
Name: NF8082_low_8
Description: NF8082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8082_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 8 - 313
Target Start/End: Original strand, 37556346 - 37556653
Alignment:
| Q |
8 |
ttggtgtttgatgcagatgtatagcgactatatgaagagttttagagagaatatggcagatttcttagaatcggagctactgatagacattgaagtagga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37556346 |
ttggtgtttgatgcagatgtatagcgactatatgaagagttttagagagaatatggcagatttcttagaatcggagctactgatagacattgaagtagga |
37556445 |
T |
 |
| Q |
108 |
cttggccctgctggagaactcagatatccttcttatgcagaatctctaggctgggtatttcctggtattggagaatttaatgtgagtttgtgaatttttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37556446 |
cttggccctgctggagaactcagatatccttcttatgcagaatctctaggctgggtatttcctggtattggagaatttaatgtgagtttgtgaatttttt |
37556545 |
T |
 |
| Q |
208 |
gctataggaatttgtgcacagttccacataacattgt-atgaaaacaaatcgactcggatcctctctcacggagcagcaaacaatattaagagt-aaaaa |
305 |
Q |
| |
|
||| ||| |||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
37556546 |
gctgtagaaatttgtgcaaagttccacgtaacattgtgttgaaaacaaatcgactcggatcctctctcacggagcagcaaacaataataagagtaaaaaa |
37556645 |
T |
 |
| Q |
306 |
gtgctatc |
313 |
Q |
| |
|
|||||||| |
|
|
| T |
37556646 |
gtgctatc |
37556653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University