View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8082_low_9 (Length: 249)
Name: NF8082_low_9
Description: NF8082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8082_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 90 - 197
Target Start/End: Complemental strand, 6993849 - 6993742
Alignment:
| Q |
90 |
gacattcttgtagtttacaacgttaatggttccttcttatagaccgagtcagagtgaagtttaacaacttgtcataattaaaggtacgttttttatatta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993849 |
gacattcttgtagtttacaacgttaatggttccttcttatagaccgagtcagagtgaagtttaacaacttgtcataattaaaggtacgttttttatatta |
6993750 |
T |
 |
| Q |
190 |
aaacaatt |
197 |
Q |
| |
|
|||||||| |
|
|
| T |
6993749 |
aaacaatt |
6993742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 6993930 - 6993881
Alignment:
| Q |
1 |
tccatccttaaaccttgatggttgtgttttatgaagacaactactcatat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993930 |
tccatccttaaaccttgatggttgtgttttatgaagacaactactcatat |
6993881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 6993730 - 6993702
Alignment:
| Q |
213 |
gggatatatgctgaatttgttatattatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6993730 |
gggatatatgctgaatttgttatattatt |
6993702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University