View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_10 (Length: 285)
Name: NF8084_high_10
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 12359657 - 12359928
Alignment:
| Q |
1 |
ggggttttggtagatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgctcaaaggaggttaatgagttagctgagg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12359657 |
ggggttttggttgatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgcttaaaggaggttaatgagttagctgagg |
12359756 |
T |
|
| Q |
101 |
agattaaagagttgccgtgacaatggagtttaaagagactgtctaaattgtattacctttatacgaatggatgtgcaatccgcgcgattgcttgcaaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
12359757 |
agattaaagagttgccgtgacaatggagtttaaagagactgtctaaattgtattacctttatacgaatggacgtgcaatccgcgcaattgcttgcaaatg |
12359856 |
T |
|
| Q |
201 |
ggctaactgagttagttttgtattggtgtgctannnnnnngtcgcctatgctagtatatgtgtgtggttttt |
272 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
12359857 |
ggctaactgagttagttttgtgttggtgtgctatttttttgtcgactatgctagtatatgtgtgtggttttt |
12359928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University