View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_12 (Length: 268)
Name: NF8084_high_12
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_12 |
 |  |
|
| [»] chr3 (17 HSPs) |
 |  |
|
| [»] scaffold0769 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
| [»] scaffold2142 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 58 - 268
Target Start/End: Complemental strand, 1459132 - 1458916
Alignment:
| Q |
58 |
atcacatcaccaatctatcatatatctatcacaagggtctct--gaaaattttaggtgagttggatttcgaaaactaaccaagtcagacatcaaagttaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
1459132 |
atcacatcaccaatctatcatatatctatcacaagggtctctatgaaaattttaggtgagttggatttcggaaactaaccaagtcagacatcaaggttaa |
1459033 |
T |
 |
| Q |
156 |
gagagcactta----caaagatacttacaaatcatcgaccaaagagattctcgtactaaaagtagaagttaaactgatcaccattgtaaagtacgagtca |
251 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
1459032 |
gagagcacttaattacaaagatacttacaaatcatcgaccaaagagatcctcgtgctaaaagtagaagttgaactggtcaccattgtaaagtacgagtca |
1458933 |
T |
 |
| Q |
252 |
actacttaccggttgaa |
268 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
1458932 |
actacttaccagttgaa |
1458916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 45183017 - 45182959
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45183017 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccttgat |
45182959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 6891034 - 6890978
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6891034 |
attatcgatcgagcccgggcgaccgcccggtgtcgccgggcggtgaaaccgcccctg |
6890978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 6931025 - 6931081
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6931025 |
attatcgatcgagcccgggcgaccgtccggggtcgccgggcggtgaaaccgcccctg |
6931081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 33040989 - 33040934
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33040989 |
attatcaatcgagcccgagcgaccgcccggggtcgccgggcggtgaaaccgcccct |
33040934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 4 - 54
Target Start/End: Original strand, 6503703 - 6503753
Alignment:
| Q |
4 |
atcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6503703 |
atcgatcgagcccgggcgaccgcccggggtcgccggacggtgaaaccgccc |
6503753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 5354739 - 5354691
Alignment:
| Q |
7 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5354739 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtgaaactgcccc |
5354691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 19565632 - 19565688
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19565632 |
attatcgattgaacccgggcgaccgcccgggatcgccgggcggtgaaaccgcccctg |
19565688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 45335911 - 45335856
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45335911 |
attatcgattgagtccgggcgaccgcccgaggtcgccgggcggtgaaaccgcccct |
45335856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 35514302 - 35514244
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
35514302 |
attatcgatcgagcccggacgaccgtccggggtcgccgggcggtgaaactgcccttgat |
35514244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 11018343 - 11018396
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
11018343 |
attatcgatcgagcctgggcgaccgcccggagtcgccggacggtgaaaccgccc |
11018396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 27935214 - 27935165
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaacc |
50 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| ||| |||||||||||| |
|
|
| T |
27935214 |
attatcgatcgagcccgggcgactgcccagggttgccaggcggtgaaacc |
27935165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34084253 - 34084289
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34084253 |
attatcgatcgagtccgggcgaccgcccggggtcgcc |
34084289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 22968575 - 22968610
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22968575 |
attatcgatcgagcccggacgaccgcccggggtcgc |
22968610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 39771826 - 39771791
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39771826 |
attatcgaccgagcccgggcgaccgcccggggtcgc |
39771791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 19390182 - 19390146
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
19390182 |
attatcgatcgaacccggacgaccgcccggggtcgcc |
19390146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 48757896 - 48757928
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
48757896 |
gcccggggtcgacgggcggtgaaaccgcccctg |
48757928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 23402144 - 23402087
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23402144 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
23402087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 2729327 - 2729382
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2729327 |
attatcgatcgagcccgggcgtccgcccggggtcgccgggcggtgaaaccgcccct |
2729382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 36408587 - 36408530
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
36408587 |
attatcgatcgagcccgggcgaccgcccgaggtcgccgggcggtgaaaccacccctga |
36408530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 4404044 - 4403994
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccg |
51 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
4404044 |
attatcgatcgagcccgggcgaccgcctggggtcgccggccagtgaaaccg |
4403994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 16788156 - 16788206
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
16788156 |
attatcgatcgagcccgggcgaccgcccggggttgccgggcaatgaaaccg |
16788206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 34136956 - 34137005
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaacc |
50 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
34136956 |
attatcgatcgagcccgggcgaccgctcggggtcgccagacggtgaaacc |
34137005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 39914551 - 39914516
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39914551 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
39914516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 10397171 - 10397220
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaacc |
50 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
10397171 |
attatcgattgagcccgggcgagtgcccggagtcgccgggcggtgtaacc |
10397220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 34844799 - 34844746
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
34844799 |
attatcgatcgagcccaggcgaccgcctagggtcgccgagcggcaaaaccgccc |
34844746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 15838322 - 15838286
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
15838322 |
attatcaatcgagcccgggtgaccgcccggggtcgcc |
15838286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 31)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 6690366 - 6690423
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6690366 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
6690423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49908783 - 49908839
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49908783 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
49908839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 5517495 - 5517553
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5517495 |
attatcgatcgagcccaggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
5517553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 3293027 - 3293083
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3293027 |
attatcgatcgagcccgggcgaccgcccggggtcactgggcggtgaaaccgcccctg |
3293083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 30216873 - 30216928
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
30216873 |
attatcgatcgagcccgggcgaccgcccggggtcgccggacggtgaatccgcccct |
30216928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 7769364 - 7769311
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
7769364 |
attatcgatcgagcccgggcgaccgcctggggtcgccggacggtgaaaccgccc |
7769311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 43143715 - 43143768
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43143715 |
attatcgatcgagcccgggcgaccgcccggggtcgtcggacggtgaaaccgccc |
43143768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 50205208 - 50205265
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
50205208 |
attatcgatcgagctcgggcgaccgcccgggatcgccggacggtgaaaccgcccctga |
50205265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 6212029 - 6212085
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6212029 |
attatcgatcgagctcgggcgaccgcccgaggtcgccggacggtgaaaccgcccctg |
6212085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 10353015 - 10353071
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
10353015 |
attatcgattgagcccgggcgaccgccaggggtcgccggacggtgaaaccgcccctg |
10353071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 17555032 - 17554978
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccc |
55 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
17555032 |
attatcgatcgagcccgggcgaccacccggggtcgtcggacggtgaaaccgcccc |
17554978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 13393004 - 13393057
Alignment:
| Q |
4 |
atcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
13393004 |
atcgattgagcccgggcgaccgtccggggtcgctgggcggtgaaaccgcccctg |
13393057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 13396143 - 13396196
Alignment:
| Q |
4 |
atcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
13396143 |
atcgattgagcccgggcgaccgtccggggtcgctgggcggtgaaaccgcccctg |
13396196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 12680193 - 12680249
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| || |||||||||||||||||||| |
|
|
| T |
12680193 |
attatcgatcgagcccgggccaccgcctggggttgctgggcggtgaaaccgcccctg |
12680249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 50720477 - 50720529
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcc |
53 |
Q |
| |
|
||||| ||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50720477 |
attattgattgagcccgggcgaccgcccgaggtcgccgggcggtgaaaccgcc |
50720529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 13012224 - 13012189
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13012224 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
13012189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 20129346 - 20129311
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20129346 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
20129311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 57
Target Start/End: Original strand, 30077763 - 30077817
Alignment:
| Q |
2 |
ttatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
30077763 |
ttatcgattgagcctgggcgaccgcccgaggtcg-cgggcggtgaaaccgcccctg |
30077817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30109992 - 30109945
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaa |
48 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30109992 |
attatcgatcgagtccgggcgaccgtccggggtcgtcgggcggtgaaa |
30109945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 47500809 - 47500774
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47500809 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
47500774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 26448089 - 26448035
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccc |
55 |
Q |
| |
|
||||||||||||| |||| ||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
26448089 |
attatcgatcgagtccggacgatcgcacggagtcgccgggcggtgaaaccgcccc |
26448035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 29996114 - 29996167
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
||||||||||||| |||| |||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
29996114 |
attatcgatcgagtccggacgaccgtccgggatcgtcgggcggtgaaaccgccc |
29996167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 57
Target Start/End: Complemental strand, 27363393 - 27363341
Alignment:
| Q |
5 |
tcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
27363393 |
tcgatcgagcccgggcgaccgcccgaggtcgccatacggtaaaaccgcccctg |
27363341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 36382476 - 36382512
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36382476 |
attatggatcgagcccgggcgaccgcccggggtcgcc |
36382512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 26439410 - 26439445
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26439410 |
attatcgaccgagcccgggcgaccgcccggggtcgc |
26439445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 34407415 - 34407450
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34407415 |
attatcgaccgagcccgggcgaccgcccggggtcgc |
34407450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 42333907 - 42333957
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccg |
51 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||| || ||||||||||| |
|
|
| T |
42333907 |
attatcgattgagcccggacgaccgcccgggatcgctggacggtgaaaccg |
42333957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 48989364 - 48989311
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |||| ||||||||||||| |||| |
|
|
| T |
48989364 |
attatcgatcgaacccggttgaccgcccggagtcgtcgggcggtgaaactgccc |
48989311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25930744 - 25930708
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
25930744 |
attatagatcgagcccgggcgaccgcccagggtcgcc |
25930708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 28877381 - 28877437
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
28877381 |
attatcgatctagcccaagcgaccgcacggggtcatcggacggtgaaaccgcccctg |
28877437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 37236646 - 37236678
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
37236646 |
gcccggggtcgccgggcggtgaaaccgctcctg |
37236678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 15)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 8147387 - 8147330
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8147387 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
8147330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 45418619 - 45418563
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45418619 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
45418563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 44084734 - 44084789
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44084734 |
attatcgatcgagcccgggcgactgcccggggtcgccgggcggtgaaaccgcccct |
44084789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 34523270 - 34523220
Alignment:
| Q |
7 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34523270 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgcccctg |
34523220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 26237991 - 26237937
Alignment:
| Q |
3 |
tatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
26237991 |
tatcgatcgagcccgggcgaccgcccggggtcgccgggctgtaaaaccacccctg |
26237937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 771034 - 770975
Alignment:
| Q |
2 |
ttatcgatcgagcccgggcgaccgcccgg-----ggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
771034 |
ttatcgatcgagcccgggcgaccgcccgggatccggtcgccgggcggtgaaaccgcccct |
770975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 42440022 - 42439986
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42440022 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
42439986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 6403935 - 6403970
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6403935 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
6403970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 8059464 - 8059523
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgatc |
60 |
Q |
| |
|
||||||||| ||||| |||||| || ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8059464 |
attatcgattgagcctgggcgatcggccggggtcgtcgggcggtgaaaccgcccttgatc |
8059523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 41251765 - 41251798
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41251765 |
attatcgatcgagcccgggcgaccgcccggggtc |
41251798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 2958231 - 2958267
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2958231 |
attatcgatcgagcccggacgaccgcccggggtcgcc |
2958267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 32127272 - 32127308
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32127272 |
attattgatcgagcccgggcgaccgcccggggtcgcc |
32127308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 57
Target Start/End: Original strand, 12756981 - 12757012
Alignment:
| Q |
26 |
cccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12756981 |
cccggggtcgccgggcggtgaaaccgcccctg |
12757012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 17445170 - 17445206
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17445170 |
attatcgatcgagctcgggcgaccgcccgaggtcgcc |
17445206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35962751 - 35962715
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
35962751 |
attatcgatcgagcccggacgaccgcctggggtcgcc |
35962715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 15)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 31680403 - 31680347
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31680403 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
31680347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 17332682 - 17332739
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17332682 |
attatcgatcgagcccgggcgaacgcccggggtcgccgggcggtgaaaccgcccctga |
17332739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 12278991 - 12279047
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12278991 |
attatcgatcgagtccgggcgaccgcccgggatcgccgggcggtgaaaccgcccctg |
12279047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 31501847 - 31501903
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
31501847 |
attatcgatcgagcccgggcaatcgcccggggtcgccgggcggtgaaaccgcccctg |
31501903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 26543902 - 26543952
Alignment:
| Q |
7 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26543902 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgcccctg |
26543952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37254677 - 37254624
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37254677 |
attatcgatcgagcctgggcgaccgcctggggtcgccgagcggtgaaaccgccc |
37254624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 202675 - 202621
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccc |
55 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
202675 |
attatcgatcgagcccgggcgaccacctagggtcgtcgggcggtgaaaccgcccc |
202621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 36291407 - 36291351
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||| |||||| ||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36291407 |
attattgatcgaacccggacgaccgcccggagtcggcgggcggtgaaaccgcccctg |
36291351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 1776507 - 1776541
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1776507 |
attatcgatcgagcccgggcgaccgcccggggtcg |
1776541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 25 - 59
Target Start/End: Complemental strand, 15917049 - 15917015
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15917049 |
gcccggggtcgccgggcggtgaaaccgcccctgat |
15917015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Original strand, 4307238 - 4307271
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4307238 |
gcccggggtcgccgggcggtgaaaccgcccctga |
4307271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 13818013 - 13817957
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
13818013 |
attatcgatcgagcccgagcgaccgcccggggtcgccatacggtagaaccgcccctg |
13817957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39434732 - 39434696
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39434732 |
attatcgatcgagcccgggcgaccgcccagggtcgcc |
39434696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 26283449 - 26283484
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26283449 |
attatcgatcgagcccgggcgaccgcccgaggtcgc |
26283484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 10033963 - 10033907
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||| |||| ||||||||||| |
|
|
| T |
10033963 |
attatcgatcgagcccgggcgatcgtccggggtcgccatacggtagaaccgcccctg |
10033907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 17)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 8867862 - 8867918
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8867862 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaactgcccctg |
8867918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 7002757 - 7002703
Alignment:
| Q |
5 |
tcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7002757 |
tcgatcgagcccgggcgaccgctcggggtcgccgggcggtgaaaccgcccctgat |
7002703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 7048628 - 7048574
Alignment:
| Q |
5 |
tcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7048628 |
tcgatcgagcccgggcgaccgctcggggtcgccgggcggtgaaaccgcccctgat |
7048574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 34389187 - 34389240
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34389187 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaatcgccc |
34389240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 33685600 - 33685544
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
33685600 |
attatcgatcgagcccgagcgactgcctggggtcgccgggcggtgaaaccgcccctg |
33685544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 43184599 - 43184655
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43184599 |
attatcgatcgagcccgagcgaccgcccggaatcgccgggcggtgaaaccgcccctg |
43184655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 37002275 - 37002330
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002275 |
attatcgatcgagaccgaacgaccgcccggggtcgccgggcggtgaaaccgcccct |
37002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 26624774 - 26624725
Alignment:
| Q |
8 |
atcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26624774 |
atcgagcccaggcgaccgcccggggttgccgggcggtgaaaccgcccctg |
26624725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 37966614 - 37966671
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||||| ||| |||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
37966614 |
attatcgatcgagctcggacgaccgcctgaggtcgccgggcggtgaaaccgcctctga |
37966671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 5555523 - 5555487
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5555523 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
5555487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 8394161 - 8394125
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394161 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
8394125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 10876838 - 10876894
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||| | |||| |||||||| ||||||| ||||||| |
|
|
| T |
10876838 |
attatcgatcgagcccgggcgaccacacgggttcgccgggaagtgaaactgcccctg |
10876894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 36630852 - 36630816
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36630852 |
attatcgatcgagcccgggcgaccgtccggggtcgcc |
36630816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 14777238 - 14777273
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14777238 |
attatcgatcgagcccgggcgaccgcccgggatcgc |
14777273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 3114227 - 3114260
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtc |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
3114227 |
attatcgatcgagcccgggcgaccgtccggggtc |
3114260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 54
Target Start/End: Original strand, 38826584 - 38826613
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38826584 |
gcccggggtcgccgggcggtgaaaccgccc |
38826613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 36658203 - 36658171
Alignment:
| Q |
27 |
ccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
36658203 |
ccggggtcgctgggcggtgaaaccgcccctgat |
36658171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 13647053 - 13646997
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13647053 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggtggtgaaaccgcccctg |
13646997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 28996766 - 28996710
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28996766 |
attatcgatcgagctcgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
28996710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 34385519 - 34385575
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34385519 |
attatcgatcgagccagggcaaccgcccggggtcgccgggcggtgaaaccgcccctg |
34385575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 21149332 - 21149390
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctgat |
59 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
21149332 |
attatcgatcaagcccgagcgaccgcccgaggtcaccgggcggtgaaactgcccctgat |
21149390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 31028495 - 31028545
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccg |
51 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31028495 |
attatcgatcgagtccgggcaaccgctcggggtcgccgggcggtgaaaccg |
31028545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 24697948 - 24698000
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcc |
53 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
24697948 |
attatcgattgagcccgggcgagtgtccggggtcgccgggcggtgaaaccgcc |
24698000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 29743319 - 29743263
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||| |||||||||| |||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
29743319 |
attatcgattgagcccgggcaaccgcccgggatcgtcggacggtgaaaccgcccctg |
29743263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 398653 - 398618
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
398653 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
398618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 2753386 - 2753330
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
2753386 |
attatcgattgagctcgggcgaccgcctagggtcgccggacggtgaaaccgtccctg |
2753330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 18339142 - 18339106
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18339142 |
attattgatcgagcccgggcgaccgcccggggtcgcc |
18339106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34948889 - 34948925
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
34948889 |
attatcgatcgagcctgggcgaccgcctggggtcgcc |
34948925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 31867013 - 31866958
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
56 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31867013 |
attatcggtcgaacccgggcgaccgcccggggtcgccgggcggtgaaaccgcccct |
31866958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 35907588 - 35907535
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35907588 |
attatcgatcaagcccgggcgaccgcccgaggtcgccgggcggtgaaaccgccc |
35907535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 44352614 - 44352670
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
44352614 |
attatcgatcgagcccgggcgacctcccggggtcgccggatggtgaaaccgcccctg |
44352670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 26144291 - 26144256
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26144291 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
26144256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 321508 - 321561
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
321508 |
attatcgatcgagcccggacgaccgcccgaaatcgccgggtggtgaaaccgccc |
321561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 17445349 - 17445293
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||| |||| ||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
17445349 |
attattgatccagcccgggcgaccgcatggggtcgccgggcaatgaaaccgcccctg |
17445293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 41972406 - 41972461
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
41972406 |
attatcgatcgagccagg-cgaccgcccggggtcgctggacggtggaaccgcccctg |
41972461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 3829020 - 3828967
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgccc |
54 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||| | ||||||||||| |
|
|
| T |
3829020 |
attatcgatcgaacccgagcgaccgtccggggttgccgggtgatgaaaccgccc |
3828967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 57
Target Start/End: Complemental strand, 33489704 - 33489667
Alignment:
| Q |
20 |
cgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33489704 |
cgaccgtccggggtcgccgggtggtgaaaccgcccctg |
33489667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 48901236 - 48901292
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctga |
58 |
Q |
| |
|
|||||||||||| ||||| | ||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
48901236 |
attatcgatcgaccccggcc-accgcccggagttgccgggcggtggaaccgcccctga |
48901292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 10907641 - 10907613
Alignment:
| Q |
25 |
gcccggggtcgccgggcggtgaaaccgcc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10907641 |
gcccggggtcgccgggcggtgaaaccgcc |
10907613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 32982187 - 32982223
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
32982187 |
attatcgatcgggcccgcgcgaccgcccggggtcgcc |
32982223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0769
Description:
Target: scaffold0769; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 1307 - 1259
Alignment:
| Q |
7 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccc |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1307 |
gatcgagcccgggcgaccgcccggggtcgccgggcggtaaaaccgcccc |
1259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 31516 - 31460
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgccgggcggtgaaaccgcccctg |
57 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
31516 |
attatcgatcgagcccgggcgaccgtctggggtcgccgggcgatgaaaccgcccctg |
31460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 194058 - 194021
Alignment:
| Q |
7 |
gatcgagcccgggcgaccgcccggggtcgccgggcggt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194058 |
gatcgagcccgggcgaccgcccggggtcgccgggcggt |
194021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 480588 - 480623
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
480588 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
480623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 5266 - 5230
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgcc |
37 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5266 |
attattgatcgagcccgggcgaccgcccggggtcgcc |
5230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2142 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold2142
Description:
Target: scaffold2142; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 558 - 523
Alignment:
| Q |
1 |
attatcgatcgagcccgggcgaccgcccggggtcgc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
558 |
attatcgatcgagcccgggcgaccgcccgggatcgc |
523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University