View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_18 (Length: 232)
Name: NF8084_high_18
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 37584854 - 37585065
Alignment:
| Q |
1 |
gtgattactattgcattagaaaaatgagccattgaaagagtacgtgcaggggagtaacagaacaacaaaattttaataggaatgggatgggatgtaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37584854 |
gtgattactattgcattagaaaaatgagccattgaaagagtacgtgcaggggagtaacagaacaacaaaattttaataagaatgggatgggatgtaataa |
37584953 |
T |
 |
| Q |
101 |
gaatagtcccacattggcaatgttaacataacagcatatatgagtttcatgagtcccacatcgaaagttttgtgagcaatagggagtaaaatcatttata |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
37584954 |
gaatagtcccacattggaaatgttaacataacagcatatatgagtttcatgagtcccacatcgaaagttttgtgagcaatagagagtaaaatcatctata |
37585053 |
T |
 |
| Q |
201 |
aaagagtagcgt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37585054 |
aaagagtagcgt |
37585065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 183
Target Start/End: Original strand, 37587902 - 37587950
Alignment:
| Q |
135 |
catatatgagtttcatgagtcccacatcgaaagttttgtgagcaatagg |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37587902 |
catatacgagtttcatgagtcccacatcgaaagttttgtgatcaatagg |
37587950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University