View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_19 (Length: 230)
Name: NF8084_high_19
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 213
Target Start/End: Original strand, 44299705 - 44299915
Alignment:
| Q |
11 |
gaagaatatagggagtgaggttgcttgtgttgggcgtgtggtaaatgtggtgtcccactgaatttgactgctcttgattcatagaggcacaagtgtggca |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299705 |
gaagaatgtagggagtgaggttgcttgtgttgggcgtgtggtgaatgtggtgtcccactgaatttgactgctcttgattcatagaggcacaagtgtggca |
44299804 |
T |
 |
| Q |
111 |
catgctttga---cttctttatttatagggggagtg-----acacaagtgtggaacatgtgaaaacaaatgattatgtgggagaatacttacttatatta |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299805 |
catgctttgacttcttctttatttatagggggggtgacacaacacaagtgtggaacatgtgaaaacaaatgattatgtgggagaatacttacttatatta |
44299904 |
T |
 |
| Q |
203 |
gggtgttaaat |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
44299905 |
gggtgttaaat |
44299915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University