View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_21 (Length: 222)
Name: NF8084_high_21
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 206
Target Start/End: Complemental strand, 41489424 - 41489237
Alignment:
| Q |
15 |
atgaacctaccatgttgaaagttagtctggggtctttttatgtatgatgagtttttcctgtgctccaactacgactatccacaattttatgaatgcaatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41489424 |
atgaacctaccatgttgaaagttagtttggggtctttttatgtatgatgagtttttcctgtgctccaactacgactatccacaattttatgaatgtaatt |
41489325 |
T |
|
| Q |
115 |
caacaaataactatgattacctacctacttctattttggaaaattaaatcagaaatacttacaacctcactcaatgtattgtaggtagagtg |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41489324 |
caacaaataactatgattac----ctacttctattttggaaaattaaatcagaaatacttacaacctcactcaatgtattgtaggtagagtg |
41489237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University