View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8084_high_22 (Length: 221)

Name: NF8084_high_22
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8084_high_22
NF8084_high_22
[»] chr2 (1 HSPs)
chr2 (1-203)||(36181881-36182083)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 36182083 - 36181881
Alignment:
1 agctatgatggctcatgcaaatcaacctagtgataacatcatatatcatgttggttcctctattagaaatccaattacctaccgtactttcagagactat 100  Q
    ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
36182083 agctatgatggctcatgcaaatcaacctaatgataatatcatatatcatgttggttcctctattagaaacccaattacgtaccgtactttcagagactat 36181984  T
101 aaccttagatatttcaccaaaaaaccattgataaacaaggatggaaaatcgattaaggttggcaatattactgtgtttagcaacatagctagcttccgga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36181983 aaccttagatatttcaccaaaaaaccattgataaacaaggatggaaaatcgattaaggttggcaatattactgtgtttagcaacatagctagcttccgga 36181884  T
201 gat 203  Q
    |||    
36181883 gat 36181881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University