View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_high_22 (Length: 221)
Name: NF8084_high_22
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 36182083 - 36181881
Alignment:
| Q |
1 |
agctatgatggctcatgcaaatcaacctagtgataacatcatatatcatgttggttcctctattagaaatccaattacctaccgtactttcagagactat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
36182083 |
agctatgatggctcatgcaaatcaacctaatgataatatcatatatcatgttggttcctctattagaaacccaattacgtaccgtactttcagagactat |
36181984 |
T |
 |
| Q |
101 |
aaccttagatatttcaccaaaaaaccattgataaacaaggatggaaaatcgattaaggttggcaatattactgtgtttagcaacatagctagcttccgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36181983 |
aaccttagatatttcaccaaaaaaccattgataaacaaggatggaaaatcgattaaggttggcaatattactgtgtttagcaacatagctagcttccgga |
36181884 |
T |
 |
| Q |
201 |
gat |
203 |
Q |
| |
|
||| |
|
|
| T |
36181883 |
gat |
36181881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University