View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_low_20 (Length: 240)
Name: NF8084_low_20
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 3414213 - 3414386
Alignment:
| Q |
1 |
ctccttaattatgatgatacatatatttaacttattgatcgagaatcatgcaggcagtgtcatcatatcgatagag--agagaactataattgttagata |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3414213 |
ctccttaattatgatgatacatatatttaacttattgatcgagaatcatgcaggcaatgtcatcatatcgatagagagagagaactataattgttagata |
3414312 |
T |
 |
| Q |
99 |
ttttagtatagtcttaaatggagtagtattttgcatagagatctaggtttgggagaattatgctattttatcta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414313 |
ttttagtatagtcttaaatggagtagtattttgcatagagatctaggtttgggagaattatgctattttatcta |
3414386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 164 - 223
Target Start/End: Original strand, 3414753 - 3414812
Alignment:
| Q |
164 |
ttttatctactgtgagacttctattttaagactagttagttgttgttgagtctccatatc |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414753 |
ttttatctaatgtgagacttctattttaagactagttagttgttgttgagtctccatatc |
3414812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University